SpaServer.ridom.de

 

Ridom SpaServer - Repeats

Download repeat sequences (FASTA)

Repeat IDKreiswirthSequence
r01GAGGAAGACAACAACAAGCCTAGC
r02A1AAAGAAGACAACAAAAAACCTGGC
r03D2GAGGAAGACAATAACAAACCTGGT
r04Z1GAGGAAGACAATAACAAGCCTGGT
r05C1AAAGAAGACAACAAAAAGCCTGGC
r06G2AAAGAAGACGGCAAAAAACCTGGC
r07U1GAGGAAGACAACAACAAACCTGGT
r08X1GAGGAAGACAACAACAAGCCTGGT
r09A2GAGGAAGACGGCAACAAACCTGGT
r10C2AAAGAAGACAATAACAAGCCTGGT
r11Y1GAGGAAGACAATAACAAGCCTGGC
r12G1AAAGAAGACAACAACAAGCCTGGT
r13E1AAAGAAGACAACAACAAACCTGGT
r14I2GAGGAAGACAACAACAAACCTGGC
r15W1GAGGAAGACAACAACAAGCCTGGC
r16K1AAAGAAGACGGCAACAAACCTGGT
r17M1AAAGAAGACGGCAACAAGCCTGGT
r18H2AAAGAAGATGGCAACAAGCCTAGT
r19H1AAAGAAGACAATAACAAGCCTGGC
r20D1AAAGAAGACAACAACAAACCTGGC
r21F1AAAGAAGACAACAACAAGCCTGGC
r22L1AAAGAAGACGGCAACAAGCCTGGC
r23J1AAAGAAGACGGCAACAAACCTGGC
r24Q1AAAGAAGATGGCAACAAGCCTGGT
r25O1AAAGAAGATGGCAACAAACCTGGT
r26T1GAGGAAGACAACAAAAAACCTGGT
r28R1AAAGAAGATGGTAACAAACCTGGC
r29F2AAAGAAGACAACAAAAAGCCTAGC
r30O2AAAGAAGACGGCAACAAAAAACCTGGT
r31N1AAAGAAGATGGCAACAAACCTGGC
r32E2AAAGAAGACAGCAACAAGCCTGGC
r33P1AAAGAAGATGGCAACAAGCCTGGC
r34B1AAAGAAGACAACAAAAAACCTGGT
r35C3GAGGAAGACAACAAAAAACCTGGC
r36W2AAAGAAGACAACAAAAAGCCTGGT
r37D3AAAGAAGACGGCAACAACAAACCTGGC
r38F3AAAGAAGACTACAAAAAACCTGGT
r39E3AAAGAAGACAGCAACAAACCTGGT
r41U2CAAGAAGACGGCAACAAGCCTGGT
r42M2AAAGAAGACAACATCAAACCTGGT
r43X2AAAGAAGACGGTAACAAACCTGGT
r44Z2AAAGAAGACAACAAGCCTGGT
r45A3AAAGAAGATGGCAACAGACCTGGC
r46Y3AAACAAGACAACAAAAAACCTGGT
r47Z3AAAGAAGACAACAACAAAAAACCTGGC
r48V2CAAGAAGACAACAACAAGCCTGGT
r49Y2GAGGAAGACAACAAACCTGGC
r50T2AAAGAAGACGGCAACAAGCCTAGT
r51P2AAAGAAGACAACAAACCTGGT
r52R3AAAGAAGACAACAAAAAACTTGGC
r53G3AAAGAAGACGTCAACAAACCTGGC
r54H3AAAGAAGACAACAAGCCTGGC
r55A4CAAGAAGACAACAACAAACCTGGC
r56J2AAGGAAGACAACAACAAGCCTGGT
r57S1AAAGAAGACAACAATAAGCCTGGC
r58B4AAAGAATACGGCAACAAGCCTGGT
r59T3AAAGAAGACAGTAACAAACCTGGC
r60S2GAGGAAGACAACAAACCTGGT
r61W3AAAGGAGATGGCAACAAGCCTGGC
r62U3AAAGAAGACGGCAATAAACCTGGC
r63V3GAGGAAAACAACAACAAGCCTGGT
r64X3AAAGAAGACAATAAAAAACCTGGT
r65S3AAAGAAGATGGCAAAAAACCTGGT
r66F4AAAGAAGACAGCAACAAGCCTGGT
r68E4AAAGAAGACGGTAACAAGCCTGGT
r69C4AAAGATGACGGCAACAAGCCTGGT
r70D4AAAGATGACGGCAACAAACCTGGT
r71Q3AAAGAAGATGGAAACAAGCCTGGT
r72P3AAAGAATACAACAACAAGCCTGGT
r73G4AAAGAAGATAACAACAAGCCTGGC
r74H4AATGAAGATGGCAACAAGCCTGGC
r75I4AAAGAAGATGGTAACAAACCTGGT
r76K3AAAGAAGACGACAACAAACCTGGT
r77AAAGAAGACGGCAACAAGCCTGAT
r78J4AAAGAATACGGCAACAAACCTGGT
r80K4AAAGAAGACAACAATAAACCTGGT
r81AAAGAAGACAGCAAAAAACCTGGT
r82AAAGAAGACAGCAACAAACCTGGC
r83AAAGAAGACGGCAAAAAACCTGGT
r84AAAGAAGATGGCAACAAACCTGAC
r85AAAGAAGACGGCAATAAACCTGGT
r86AAAGAAGACGACAAAAAACCTGGC
r87AAAGAAGATGGCAACAAGCCTGAT
r88AAAGAAGACGGCAGCAAGCCTGGT
r89GAAGAAGACGGCAACAAACCTGGT
r90I1AAAGAAGGCAACAAAAAACCTGGT
r91AAATAAGACAACAAAAAACCTGGT
r92AAAGAAGACAACAACAAACATGGC
r93CAAGAAGACAACAACAAGCCTGGC
r94CAAGAAGACAACAACAAACCTGGT
r95GAGGAATACAATAACAAGCCTGGC
r96AAAGAAGACGGCAACAAAACTGGT
r97AAAGAAGACACCAACAAGCCTGGT
r98AAAAAAGACGGCAACAAACCTGGT
r99GAGGAAGACAATAACAAGCCTAGT
r100AAAGAAGACAACAAAAAACCTGAC
r101AAATAAGACAACAACAAGCCTGGT
r102AAAGAAGACAACAACAAACCTGAT
r103AAAGAAGACGGCAACAAACCTGGG
r104AAAGAAGGCGGCAACAAACCTGGT
r105AAAGAAGATAACAAAAAACCTGGT
r106GAGCAAGACAACAACAAGCCTGGT
r107AAAGAAGACGGCAACAAACCTGAC
r108AAAAAAGACAACAACAAACCTGGT
r109AAAGAAGACGGCAACAAACCTAGC
r110AAAGAAGACGACAACAAGCCTGGT
r111AAAGAAGATGGCAACAAACTTGGT
r112AAAGAAGATGGAAACAAGCCTGGC
r113AAAGAAGACAACAAAAAACCCGGT
r114AAAGAAGACGGTAACAAACCTGGC
r115AAAGAAGACAACAAAAAGCCTACC
r116AAATAAGACAATAACAAGCCTGGC
r117AAAGAAGATGGTAACAAGCCTGGT
r118AAAGAAGACGTCAACAAGCCTGGT
r119AAATAAGACGGCAACAAGCCTGGT
r120AAAGAAGACAACAAAAAACCTGAT
r121GAGGAAGACAACAAGCCTGGT
r122GAGGAAGACAACAAAAAACCTGGA
r123GAGGAAGACAACAACAATCCTGGC
r124GAGGAAGGCAACAAAAAACCTGGT
r125GAGGAAGACGGCAACAAACCTGGC
r126GAGGAAGACAACAAAAAGCCTAGC
r127AAAGAAGACAACAAAAAACCTGTC
r128AAAGAAGACAACAACAAGCCTAGT
r129AAAGAACACAACAAAAAACCTGGT
r130AAAGAAGACGGCAACAAGTCTGGT
r131AAAGAAGACAACAACAAGCTTGGC
r132AAAGAAGACGGCAACAAGCCTAGC
r133AAAAAAGACGGCAACAAGCCTGGT
r134AAAGAAGGCAACAAGCCTGGC
r135GAGGAAGACAACAAAAAGCCTGGT
r136GAGGAAGACAACAACAAATCTGGT
r137GAGGAAGGCAATAACAAGCCTGGC
r138AAAGAAGACAACAAAAAACTTGGT
r139AAAGAAGACAACAACAACCCTGGT
r140GGAGAAGACAACAAAAAACCTGGT
r141AAAGAAGACGGCAACCAGCCTGGT
r142GAGAAAGACAACAACAAGCCTAGC
r143AAAGAAGACAACAAAAAGCCTAGT
r144AAAGAAGACACCAACAAACCTGGT
r145AAAGAAGACGGCAACAAGCCTGGA
r146AAAGAAGATGGTAACAAACCTGGA
r147AAAGAATACAACAAAAAACCTGGT
r148AAAGAAGACAACAACAAGACTGGT
r149AAAGAAGACGGCAACAATCCTGGT
r150AAAGAAGAAGGCAACAAACCTGGT
r151AAAGAAGACGGCAAGAAGCCTGGT
r152AAAGAAGACAACAACAACAAGCCTGGC
r153AAAGAAGATGGCAATAAGCCTGGT
r154AAAGAAGACAACAAAAAACCTGTA
r155AAAGAAGACGGCAACAAGCCTTGT
r156AAAGAAGACAACAACAAGCCTAGC
r157AAAAAAGACAACAAAAAACCTGGC
r158AAAGAAGACGGAAACAAACCTGGT
r159AAAGAAGACAACAAAAAACCTAGC
r160GAGGAAGACAACAAAAAGCCTGGC
r161AAAGAAGAGGGCAACAAGCCTGGT
r162AAAGAAGATAGCAACAAACCTGGT
r163GAGGAAGACAACTACAAGCCTGGT
r164GAGGAAGACGGCAACAAGCCTGGT
r165AAAGAAGACGGCAACAAAGCTGGC
r166AAAGAAGACGTCAACAAACCTGGT
r167AAAGAAGACGGCAACAAAAAGCCTAGC
r168AAAGAAGATGGCAACCAGCCTGGC
r169AAAGAAGACGACAAAAAGCCTAGC
r170AAAGAAGATCGCAACAAACCTGGT
r171AAAGAAGACGGGAACAAACCTGGC
r172AAAGGAGACAACAAAAAACCTGGT
r173CAAGAAGACAACAAAAAACCTGGT
r174AAAGAAGATAACAACAAGCCTGGT
r175AAAGAAGATAGCAACAAACCTGGC
r176AAAGAAGACGGCAACGGCAACAAACCTGGC
r177AAAGAAGACAACAGAAAACCTGGT
r178AAAAAAGACAACAACAAGCCTGGT
r179AAAAAAGACAACAACAAGCCTGGC
r180AAAGAAGATGACAACAAGCCTGGT
r181AAAGAAGACGGCATCAAACCTGGT
r182AAAGAAGACACCAAAAAACCTGGC
r183AAAGAAGACAACAACAAACCTAGC
r184AAAGAAGAAAACAACAAGCCTGGT
r185AAAGAAGACAACAAAAAACATGGC
r186GAGGAAGATAACAACAAACCTGGT
r187AAAGAAGACGGCAACTAACCTGGC
r188CAAGAAGACGGCAACAAACCTGGT
r189AAAGAAGATAACAAGCCTGGT
r190TAGGAAGACAACAACAAGCCTGGC
r191AAAGAAGATGCCAACAAGCCTAGT
r192AAAGAAGACAACTACAAACCTGGT
r193GAGGAAGACAACAACAAGCCTAGT
r194AAAGAAGACAACAAAAAAACTGGT
r195AAAGAAGACGGCAACAAGCCTCGT
r196AAAGAAGACAACAACAAGCCTGCC
r197AAAGAAGACAACAACAATCCTGGC
r198AAAGAAGACAATAACAAGCCAGGC
r199GAAGAAGACAACAAAAAACCTGGT
r200AAAGAAGACAATAACAGGCCTGGC
r201AAAGGAGACAACAACAAACCTGGC
r202AAAGAAGACGACAACAAACCTGGC
r203AAAGAAGGCAACAACAAACCTGGT
r204AAAGAAGACAACAAAAAACATGGT
r205AAAGAAGACGGCAAAAAGCCTAGC
r206AAAGAAGACAACAACAATCCTGGT
r207AAAGAAGACGATAACAAGCCTGGT
r208AAAGAAGATAACAAAAAACCTGGC
r209AAAGAAGACAACAACAAGTCTGGC
r210GAGGAAGACAACAACAATCCTGGT
r211AAAGAAGACGGCAACAAGCCCGGT
r212AAAGAAGACGACAAAAAACCTGGT
r213AAAGAAAACAACAACAAACCTGGT
r214AAAGAAGAAGACAACAAGCCTGGT
r215AAAGAAGACAACAACAAGCCTGAT
r216AAAGAAGACAACGAAAAACCTGGT
r217AAAGAAGATGGCAACAAAAAGCCTGGC
r218AAAGAAGAGAACAACAAACCTGGT
r219AAAGAAGACGGCAACAAACTTGGC
r220AAAGAAGCCGGCAACAAACCTGGT
r221GAGGAAGACAACAACAAGCCTGAC
r222AAAGAAGACAACAAAAAATCTGGT
r223AAAGAAGACGGCAACAAACCCGGC
r224AAAGAAGACAACAAAAATCCTGGC
r225AAAGAAGACGGCAACAAGACTGGT
r226AAAGAAGACAAAAAAAAACCTGGT
r227AAAGAAGATGGCAACAAACCCGGT
r228AAAGAAGACAATAACAAACCTGGT
r229AAAGAAGAAGGCAACAAACCTGGC
r230AAAGAAGATGGCAACAAGTCTGGT
r231AAAGAAGATGGTAACAAACCTCGC
r232AAAGAAGACAACAAAAAAACTGGC
r233GAGGAAGACAACAAAAAAACTGGT
r234GAGGAAGACAGCAACAAACCTGGT
r235AAAGAAGACAACAAAAAACCCGGC
r236CAAGAAGACGGCAACAAACCTGGC
r237AAAGAAGACAACGACAAGCCTGGT
r238AAAGAAGATGGCAACAAGCCTAGC
r239AAAGAAGATGGCTACAAACCTGGC
r240GAGGAAGACAGCAAAAAACCTGGT
r241AAATAAGACGGCAACAAACCTGGT
r242AAAGAAGACGGCAACAAACCTGTT
r243AAATAAGACAACAAAAAACCTGGC
r244AAAGAAGACGGCAACAAATCTGGC
r245GAGGAAGACAACAACAAGCTTGGC
r246AAAGAATATGGCAACAAACCTGGC
r247AAAGAAGATGGCAACAAATCTGGT
r248AAAAAAGACGGCAACAAGCCTGGC
r249AAAGAAGATGGTAACAAGCCTGGC
r250AAAGAAGATGGTAACAAACCTGCA
r251GAGGAAGACAACAAAAAACCTGAT
r252AAAGAGGATGGTAACAAACCTGGC
r253TAAGAAGACGGCAACAAACCTGGC
r254AAAGAAAACAACAAAAAACCTGGT
r255GAGGGAGACAATAACAAGCCTGGT
r256AAAGAAGACAACAAAAAACCTAGT
r257AAAGAAGACAACAACAAACCAGGC
r258GAAGAAGACAATAACAAGCCTGGT
r259GATGAAGACAACAACAAGCCTGGT
r260AAAGAAGACTCCAACAAACCTGGT
r261AAAGAGGACGGCAACAAGCCTGGT
r262AAAGAAGACGGCAAAAAGCCTGGC
r263AAAGAAGACAACAAAAAATCTGGC
r264AAAGAAGACGACAACAAGCCTGGC
r265AAAGAAGACGGCAACAAACCTGAT
r266AAAGAAGACGGCAACAAACCTGTC
r267AAAGAAGATAACAACAAACCTGGC
r268GAGGAAGACAACAATAAACCTGGT
r269AAAGAGGACAACAACAAGCCTGGC
r270AAAGAAGGCGGCAACAAGCCTGGT
r271AAATAAGACAGCAACAAACCTGGT
r272CAAGAAGACGGCAACAAGCCTGGC
r273AAAGAAGACGGCAACAAACCTGGA
r274AAAGAAGACGGCAACAAACCTGTA
r275AAAGAAGACGGCAACAAACTTGGT
r276AATGAAGACGGCAACAAGCCTGGT
r277CAAGAAGACGACAACAAGCCTGGT
r278GAGGAAGACAACAACAAGCCAGGT
r279AAAGAAAATGGCAACAAACCTGGT
r280AAAGAAGATGGTAACAAACCTAGC
r281AAAGAAGATGGCAACAAACCTGAT
r282AAAGAAGACAACAACAAACCTGGA
r283GAGGAAGACAACAACAAACTTGGT
r284AAAGAAGACAACAAAAAACCTGCC
r285AAAGAAGATGGCAACAAACCTAGT
r286AAAAAAGACAACAAAAAACCTGGT
r287AAAGAAGACGGCAACAAGCTTGGT
r288AAGGAAGACAATAACAAGCCTGGT
r289AAAGAAGAAAACAAAAAACCTGGT
r290CAAGAAGATGGTAACAAACCTGGC
r291AAAGTAGACGGCAACAAGCCTGGT
r292GAGGAAGACAACAACAAAAAACCTGGC
r293AAAGAAGACGGCAATAAGCCTGGT
r294AAAGAAGATGGCAACATACCTGGT
r295AAAGAAGATGGCAACAAACCTAGC
r296AAAGAAGATGGCAACAAAAAACCTGGC
r297AAAGAAGACGGAAACAAGCCTGGT
r298AAAGAAAACGGCAACAAGCCTGGT
r299GATGAAGACAACAACAAACCTGGC
r300GAGAAAGACAACAAAAAACCTGGT
r301AAAGAAGACAACAACAAGTCTGGT
r302GAGAAAGACAACAACAAGCCTGGC
r303AAAGAGGACGGCAACAAACCTGGT
r304AAAGAAAACGGCAACAAACCTGGC
r305GAGGAAGACAACAACAAGCGTGGC
r306AAAGAAGATGGGAACAAGCCTGGC
r307AAAGAAGACGGCAACAACCCTGGT
r308AAAGAAGACAACAAAAATCCTGGT
r309AAAGAAGACGCCAACAAGCCTGGT
r310AAAGAAGATGGCAACAATCCTGGC
r311AAAGAAGATGACAACAAACCTGGT
r312AAAGAAGATAGTAACAAACCTGGC
r313AAAGAAGGCAACAACAAGCCTGGT
r314AAAGAAAACGGCAACAAACCTGGT
r315CAAGAAGACAACAAAAAACCTGGC
r316GAGGAAGACAACAAAAATCCTGGT
r317GAGTAAGACAACAAAAAACCTGGT
r318CAAGAAGATGGCAACAAGCCTGGC
r319AAAGAAGATGGCAACAAGCCTCGC
r320AAAGAAGATGGCAACAAGCCCGGT
r321AAAGAAGGCGGTAACAAACCTGGT
r322AAAGAAGACAACAACAAGCTTGGT
r323AAAGAAGACTGCAACAAGCCTGGT
r324TAGGAAGACAACAACAAGCCTGGT
r325AAAGAAGACTACAAAAAACCTGGC
r326AAAGAAGATGGAAACAAACCTGGT
r327AAAGAAGACGGCAACAAACATGGT
r328AAAGATGGCAACAAACCTGGT
r329AAAGAAGACAACAACAACAAACCTGGT
r330AAAGAAGACAACAGCAAGCCTGGT
r331GAAGAAGACGGCAACAAGCCTGGT
r332AAAGAATATGGCAACAAACCTGGT
r333CAGGAAGACAATAACAAGCCTGGC
r334GAAGAAGATGGCAACAAGCCTGGC
r335GAGGAAGACGGCAACAAACCTAGT
r336GAGGAAGATAACAACAAGCCTGGC
r337AAAGAAGACCGCAACAAACCTGGT
r338AAAGAAGACCACAACAAGCCTGGT
r339AAAGAAGACTACAACAAACCTGGT
r340AAAGAAGACAGCAAAAAGCCTAGC
r341GAGGAAGACAATAATAAGCCTGGT
r342AAAGAAGACGGCAACAAATCTGGT
r343AAAGAAGATGGCAACAAGCCAGGT
r344GAGGAAGGCAACAACAAGCCTGGC
r345GAGGAAGACAACAACAAACCAGGT
r346AAAGAAGACTACAACAAGCCTGGT
r347AAAGAAGACAACAAAAAGTCTAGC
r348AAAGAAGATGGCAACAGACCTGGT
r349AAAGAAGATGGCAGCAAGCCTGGT
r350AAAGAAGATGGTAACAAGCCTAGT
r351AAAGAAGACAACAAACCTGGC
r352GAGGAAGACATTAACAAGCCTGGC
r353GAGGAAGACAACAACAAGTCTGGT
r354AAAGAAGACAACAAAAACCCTGGT
r355AAAGAAGACGGCAACAAACCTTGC
r356GAGGCAGACAATAACAAACCTGGT
r357AAAGAAGATGGCAAAAAACCTGGC
r358AAAGAAGGCGGCAACAAACCTGGC
r359AAAGAAGATGGCGACAAACCTGGT
r360AAAGAAGATGGCAACAACCCTGGT
r361GAGGAAGACAGCAACAAGCCTGGT
r362AAGGAAGACGGCAACAAGCCTGGT
r363AAAGAAGATGGCAATAAACCTGGT
r364GAGGAAGACAATAACAAGCCTAGC
r365GAAGAAGATGGCAACAAGCCTGGT
r366AAAGAAGACCGCAACAAACCTGGC
r367AATGAAAACGGCAACAAGCCTGGT
r368AATGAAGACGGCAACAAACCTGGC
r369ACAGAAGACGGCAACAAACCTGGT
r370GATGAAGACAACAAGCCTGGT
r371AAAGAAGATAACAACAAACCTGGT
r372AAAGAAGATAGCAACAAGCCTGGT
r373GAGGAAGACGGCAAAAAACCTGGT
r374AAAGAAGACACCAACAAACCTGGC
r375AAAGAAGACGGCAACAATCCTGGC
r376GAGGAAGACAATAACAAGCCTGCC
r377AAAGAAAACAACAACAAACCTGGC
r378GAGGAAGACAACAACAAGCCCGGC
r379AAAGCAGACAACAAAAAACCTGGT
r380AAAGAAGACAACAACTAGCCTGGT
r381GAGGAAGACAACAACAAACCCGGC
r382AAAGAAGACGGCAACAAGCCAGGT
r383AAAGAAGACAACAAAAAACCAGGT
r384AAAGAAGATGGCAACAAACCTGTA
r385GAGGAAGACAACAACAAGCCTGAT
r386AAAGAAGACAACAATAAGCCTAGC
r387AGAGAAGACAACAAAAAACCTGGT
r388GAGGAAGATAATAACAAACCTGGT
r389AAAGAAGATAGCAACAAGCCTGGC
r390AAAGAAGATGGTAACAAACCCGGC
r391GAGGAAGATAATAACAAGCCTGGT
r392AAAGAAGACGGCAACATACCTGGT
r393AAAGAAGATGGCAACAAGCCTGCC
r394AAAGAAGATAGCAACAAGCCTAGT
r395AAAGAAGACAACAACAAGCCCGGT
r396AAGGAAGACGGCAACAAACCTGGT
r397AAAGAAGACAACAAAAAACCTCGT
r398GAGGAAGACAATAACAATCCTGGC
r399GAGGAAGATAACAAAAAACCTGGT
r400AAAGAAGACGGCAACAAAAAGCCTGGT
r401GAGGAAGACAACAACAAGCTTGGT
r402GAGGAAGGCAACAACAAGCCTGGT
r403AAGGAAGACAACAAGCCTGGT
r404AAAGAGGACAACAAAAAACCTGGC
r405TAAGAAGACGGCAACAAACCTGGT
r406AAAGAAGACGGCTACAAACCTGGT
r407AAAGAAGACGGTAACAAGCCTGGC
r408AAAGAAGACGGCAATAAGCCTGGC
r409AAGTAAGACAACAAAAAACCTGGT
r410GAGTAAGACAACAACAAGCCTGGC
r411GAGGAAGACACCAACAAGCCTGGT
r412AAGGAAGACAACAACAAGCCTGGC
r413AAAGAAGACAACAACACGCCTGGC
r414AAAGAAGACAACAATAAGCCTGGT
r415AAAGAAGATGGCAACATGCCTGGC
r416AAAGAAGACAACAACCAACCTGGC
r417GAAGAAGATGGCAACAAACCTGGC
r418AAAGAAGATGACAACAAGCCTGGC
r419AAAAAAGATGGCAACAAACCTGGC
r420AAATAAGACAACAACAAACCTGGC
r421AAAGAAGACAACAACAAACCTGTT
r422AAAGAAGACGACAACAACAAGCCTGGT
r423AAATAAGACGGCAACAAACCTGGC
r424AAAGAAGACAACAACACGCCTGGT
r425AAAGAAAACAACAAAAAACCTGGC
r426AAAGAAGACGACAACAAAAAACCTGGT
r427AAAGAAGGCAACAACAAACCTGGC
r428GAGGAAGACAGCAACAAGCCTGGC
r429GAGGAAGACAATAACAAGACTGGC
r430AAAGAATACAACAACAAGCCTGGC
r431AAAGAACACGGCAACAAGCCTGGT
r432AAAGAAGACGGCATCAAACCTGGC
r433AAAGAAGACAACAACAAGCCTCGT
r434AAAGAAAACAACAACAAGCCTGGT
r435AAAGAAGACAGCAAAAAACCTGGC
r436AAAGAAGACTGCAACAAACCTGGT
r437AAAGAAGACAACAACAAGCCTGAC
r438AAAGAAGACGGCAAGAAACCTGGC
r439AAAGAAGACAACAACAAACTTGGT
r440AAAGAAGACGGCAGCAAACCTGGT
r441AAAGAAGATGGAAACAAACCTGGC
r442AAAGAAGACAACAACAAACTTGGC
r443AAATAAGACAACAAAAAGCCTAGC
r444AAAGAAGTCAACAACAAGCCTGGT
r445AAAGAAGACGGCAACAAGCATGGT
r446AAAGAAAATGGCAACAAACCTGGC
r447AAAGAAGACAACAACAAGCCTGGA
r448AAAGAAGATGGCAACAATCCTGGT
r449GGGGAAGACAATAACAAGCCTGGT
r450ACAGAAGACGGCAACAAGCCTGGC
r451AAAGAAGACAACAAAAAGCCTATT
r452AAAGAAGACGGCAACAAACCCGGT
r453AAAGAAGATGGCAACAAAGCTGGC
r454AAAGCAGACAACAAAAAACCTGGC
r455AAAAAAGACGGCAACAAACCTGGC
r456GAGGAAGACAACAACAAGTCTGGC
r457AAAGAAGACAACAAAAAAGCTGGT
r458AAAGAAGACGGCAGCAAACCTGGC
r459AAAGAAGACAACAACAACAAGCCTGGT
r460AAAGAAGACAACAACAAGGCTGGT
r461AAAGAAGACAACAACAAAACTGGT
r462AAAGAAGACATCAACAAACCTGGT
r463AAAGGAGACGGCAACAAACCTGGT
r464AAAGATGACGGCAACAAACCTGGC
r465GAGGAATACAATAACAAGCCTGGT
r466AAAGAAGACGGCAACAAACCTGCC
r467AAAGAAGACAACAAAAAGCCTAAC
r468GAAGAAGACAACAACAAGCCTGGT
r469AAAGAAGACAACAACAAGCATGGC
r470AAAGAAGACAACAAAAGACCTGGT
r471AAAGAAGACAACAAAAAGCCTGAC
r472GAGGAAAACAACAACAAACCTGGC
r473AAAGAAGACGGCAACAGGCCTGGT
r474AAAGAAGACGGCAACAAGCCGGGT
r475AAAGAAGACGGCAACAAACCTAGT
r476AAAGCAGATGGCAACAAACCTGGT
r477AAAGAAGACAACGACAAGCCTGGC
r478GGGGAAGACAACAACAAGCCTGGC
r479GAGGAAGACAATAACAAACCTGGC
r480GCTGACAACAAAAAACCTGGT
r481AAAGAAGATTGCAACAAGCCTGGC
r482AAAGAAGACGGCAACGAGCCTGGT
r483GAGGAAGACAACAACAAGCCGGGC
r484AAAGAAGATTGCAACAAACCTGGT
r485AAAGAAAACAACAAAAAGCCTAGC
r486AAAGAAGACAACAACAAACCTGAC
r487AAAGAAGATGGCAACAAGACTGGT
r488AAAGAAGACAACAACGAGCCTGGT
r489AAATAAGACAATAACAAGCCTGGT
r490AAAGAAGACAACCACAAGCCTGGT
r491AAAGAAGATGGCAACCAGCCTGGT
r492ATAGAAGACAACAACAAGCCTGGC
r493AAAGAAGATGGCAACTAACCTGGT
r494AAAGAAGACAGCAACAAGTCTGGC
r495AAAGAAGACAACAAAAAACCAGGC
r496GAAGAAGACAATAACAAGCCTGGC
r497AAAGAAGACGGCAACAAGGCTGGT
r498AAAGAAGATGGCAACCAACCTGGT
r499GAGGAAGATAATAACAAGCCTGGC
r500AAAGAGGACGGCAACAAACCTGGC
r501AAAGAAGATGGCAACAAACCTGTT
r502AAAGAAGACAACAACAAACCCGGT
r503AAAGAAGACCGCAACAAGCCTGGT
r504AAAGAAGATGGCAACAAACCCGGC
r505AAAGAATACAACAAAAAACCTGGC
r506AAAGAAGACGGCATCAAGCCTGGT
r507AAAGAAGACAACAACCCTGGT
r508GAGGAAGACAACAAAAAACCTAGC
r509AGAGAAGATGGCAACAAACCTGGT
r510AAAGAAGGTGGCAACAAACCTGGT
r511AAAGAAGATGTCAACAAGCCTGGT
r512AAAGAAGATAACAAAAAGCCTGGC
r513AAAGAAGACTGCAACAAACCTGGC
r514AAAGAAGACAAGAACAAGCCTGGT
r515AAAGAAGATGGCAACAAGCTTGGT
r516GAGGAAGACAACAACAAACCTGTT
r517AAAGAAGACTCCAACAAACCTGGC
r518AAAGAAGATGGCAAAAAGCCTAGC
r519AAAGAAGACAACAGCAAGCCTGGC
r520AGAGAAGACGGCAACAAACCTGGT
r521GAGGAAGACAACAACAAGCCTGCC
r522AAAGAAGACAACAATAAACCTGGC
r523AAATAAGATGGCAACAAACCTGGT
r524GAGAAAGACAATAACAAGCCTGGC
r525AAAGAAGATGGCAACAAAACTGGT
r526AAAGAAGACGCCAACAAACCTGGT
r527AAAGAATATGGCAACAAGCCTGGT
r528AAAGAAGACAACCAAAAACCTGGC
r529AAAGAAGGTGGTAACAAACCTGGC
r530GAGGAGGACAATAACAAGCCTGGT
r531AAAGTAGATGGTAACAAACCTGGC
r532AAAGAAGACAACAAAAAACCGGGT
r533AAAGAATACGGCAACAAACCTGGC
r534AAAAAAGATGGTAACAAACCTGGC
r535GAGGAAGACAACAATAAGCCTGGT
r536AAAGAAGAGGGCAACAAACCTGGC
r537AAATAAGACAACAACAAGCCTGGC
r538AAAGGAGACAACAACAAGCCTGGT
r539AAAGAAGACAACAACAAACCACCT
r540AAAGAAAACGGCAACAAGCCTGGC
r541GAGAAAGACAACAACAAACCTGGT
r542AAAGAAGACAACAACGAACCTGGT
r543AAAGAAGATGGCAACAAAAAACCTGGT
r544GAGGAAGACGGCAAAAAACCTGGC
r545GAGGAAGGCAACAAACCTGGT
r546AAAGAAGACAACAAGAAACCTGGT
r547AAAGAAGATAACAAAAAGCCTAGC
r548GAGAAAGACGGCAACAAACCTGGT
r549AAGGAAGACAACAAAAAACCTGGT
r550GAAGAAGATGGTAACAAACCTGGC
r551GAGGAAGACAAAAACAAGCCTGGC
r552AACGAAGATGGCAACAAGCCTGGC
r553AAAGAAGACAACAACCAGCCTGGT
r554AAATAAGACAACAACAAACCTGGT
r555GAGGAAGACACTAACAAGCCTGGT
r556AAAGAAGACGATAACAAGCCTGGC
r557AAAGAAGACATCAACAAGCCTGGT
r558AAGGAAGACGGCAACAAGCCTGGC
r559AAAGAGGATGGCAACAAGCCTGGT
r560AAAGAAGATGACAACAAACCTGGC
r561GAGGAAGACAACAACAAACATGGT
r562AAAGAAGAGAACAAAAAACCTGGT
r563AAGGAAGACAATAACAAGCCTGGC
r564AAAGAAGAAAACAAAAAACCTGGC
r565AAAGAAGATAGCAACAGACCTGGC
r566GAGGAAGACAATAAGCCTGGT
r567TAAGAAGACGGCAACAAGCCTGGT
r568AAAGAAGACAACAAAAAACCTTGT
r569AAGGAAGACAACAACAAACCTGGT
r570GAGGAAGGCAATAACAAGCCTGGT
r571AAAGAAGGCAACAAAAAACCTGGC
r572AAAGAAGATGGCAACAAGCCTGGG
r573GAGGAAGACAATAACAGGCCTGGT
r574AAAGAAGATGGCAACAAGCCTTGC
r575AAAGAAGATGGCAACAAGGCTGGC
r576AGAGAAGATGGCAACAAGCCTAGT
r577AAAGAAGATGGCAACAAACCAGGT
r578AAAGAAGACTGCAACAAGCCTGGC
r579AAAGAAGACAACAAAAATCCTAGC
r580GAGGAAGACAACAACAAACCTCGG
r581AAAGAAGATAATAACAAGCCTGGC
r582AAAGAAGACGGCAACAAGCCTGTT
r583AAAGAAGACAACAACATGCCTGGC
r584GAGGAAGACAAGAACAAACCTGGT
r585GAGGAAGAGAATAACAAGCCTGGC
r586GAGGAAGACAATAAAAAACCTGGT
r587AAAGAAGACAACAACAGGCCTGGT
r588CAAGAAGACAACAAGCCTGGT
r589GAAGAAGACAACAAAAAACCTGGC
r590AAAGAAGGTGGCAACAAGCCTAGT
r591GAGGAAGACAACAAGCCTGGC
r592GAGTAAGACAATAACAAGCCTGGT
r593AAAGAAGACGGCAACCAGCCTGGC
r594AAAGGAGATGGCAACAAACCTGGC
r595GAGGAAGACCATAACAAGCCTGGC
r596AAAGAAGACAACAACAAGACTGGC
r597GATGAAGACAACAAGCCTGGC
r598AAAGAAGACAACAAAACACCTGGC
r599CAAGAAGATGGCAACAAGCCTGGT
r600AAAGAAGACAATAACAAACCTGGC
r601AAAGCAGACAACAACAAACCTGGC
r602AAAGAAGACGGCACCAAGCCTGGT
r603GAGTAAGACAATAACAAGCCTGGC
r604AAAGAAGACAACACAAAACCTGGT
r605AAAGAAGACAAGAACAAGCCTGGC
r606AAAGAAGACGATAACAAACCTGGT
r607GAGGAAGACAGCAACAAGCCCCTG
r608GAGGAAGACAATAAAAAGCCTGGT
r609GAGGAAGACAATAACAAGCCTGTT
r610AAAGAAGATGACAACAAGCCTAGT
r611GCTGACAACAACAAGCCTGGT
r612AAAGAAGACAATAACTAGCCTGGC
r613AAAGAAGACAACTACAAGCCTGGC
r614AAAGAAGACAATAACAAGCCCGGC
r615AAAGAAGATGTCAACAAACCTGGC
r616AAAGAATACGGCAACAAGCCTGGC
r617GAGGAAGACAACAACAAAAAACCTGGT
r618CAAGAAGATGGCAACAAACCTGGT
r619GAGTAAGACAACAACAAGCCTGGT
r620AAAGAAGATGGCAACAAGCCTGGA
r621TAGGAAGACAACAACAAACCTGGT
r622AAAGAAGATGGCAATAAGCCTGGC
r623AAAGCAGACGGCAACAAACCTGGT
r624GAGGAAGACAATAACAAGACTGGT
r625AAAGAAGACAACAACAAACCTAGT
r626AAAGAAGACAACAACAAGCCAGGT
r627AAAGAAGACGGCAAGAAACCTGGT
r628AAAGAAGATGGCAACGAGCCTGGT
r629GAGGAAGACAGCAACAAACCTGGC
r630GAGGAATACAACAAGCCTGGT
r631AAAGAAGACAACAACAAGCCTGTT
r632AAAGAAGACGGCAACAACCCTGGC
r633AAATAAGATGGCAACAAGCCTGGT
r634AAAGAAGACGGCAACAAACCTCGT
r635AAAGAAGACGGCAACAAGCCTGCT
r636GAGGAAGACAATAAGAAGCCTGGT
r637GAGGAAGAAAATAACAAGCCTGGC
r638AAAGAAGAAAACAACAAGCCTGGC
r639AAAGAAGACGGCAACAGACCTGGC
r640AAAGAAGAGGGTAACAAACCTGGC
r641GCTGACAACAACAAGCCTGGC
r642AAAGAAGACAATAACAAGACTGGC
r643AAAAAAGATGGCAACAAGCCTGGT
r644GAGGAAGACAACAACAAACCCGGT
r645GAGGAATACAACAAAAAACCTGGT
r646AATGAAGACAACAACAAGCCTGGT
r647AACGAAGACGGCAACAAGCCTGGC
r648AAAGAAGACGGCAACAAGCAGCCTGGT
r649AAAGAAGACAACAACAAAAAACCTGGT
r650AAAGAAGATGGCAACAAACCTTGT
r651AAAGAAGACAACAACAAGCCTTGT
r652AAAGAAGACAACAAAATACCTGGT
r653GAGAAAGACAATAACAAACCTGGT
r654AAAGAAGACAACCAAAAACCTGGT
r655AAAGAGGACAACAACAAGCCTGGT
r656GAAGAAGACAACAACAAACCTGGC
r657AAAGAAGACAGAAACAAACCTGGC
r658AAAGAAGACGGCAACAAGCCTGTC
r659AAAGAAGATGGCAACAAGTCTGGC
r660AAAGAAGGCAACAACAAGCCTGGC
r661AAACAAGACGGCAACAAGCCTGGC
r663AAAGAAGACGGCAAAAAGCCTGGT
r664AAAGAAGATGGCAACAAGCCTGTT
r665AAAGAAGACAGCAAAAAGCCTATC
r666AAAGAAGATGGCAACAAACCGGGT
r667AAAGAAGATCGCAACAAGCCTGGT
r668AAAGAAGACGTCAACAAGCCTGGC
r669AAAGAAGAGAACAACAAGCCTGGC
r670AAAGAAGACAACAAAAGACCTGGC
r671AAAGAAGTCAACAAAAAACCTGGT
r672AAAGAAGGCAACAAACCTGGT
r673AAAAAAGACAACAACAAACCTGGC
r674GAGGAAGACAATAACAAGCTTGGC
r675GAGGAAGACAATAACAAGCCTGAT
r676AAAGAAGATGGCAACAAACCTGGA
r677AAAGAAGACGGGAACAAACCTGGT
r678AAAGAAGACAATAACAAGGCTGGC
r679AAAGAGGATGGCAACAAACCTGGT
r680TAAGAAGACAACAACAAGCCTGGT
r681GAGGAAGACGACAACAAACCTGGT
r682GAAGAAGACAACAACAAGCCTGGC
r683AAAGAAGGCAACAAGCCTGGT
r684AAAGAAGACGGAAACAAACCTGGC
r685AAAGAAGATGGCAAGAAACCTGGT
r686AAAGAAGACAACAACAAATCTGGT
r687AAAGAAGACGACAACAAGCCCGGT
r688AAAGAAGACAACAAAAAACCTGCT
r689AAAGAAGATGGTAACAAAGCTGGC
r690AAATAAGACGGCAACAAGCCTGGC
r691AAAGAAGACAACAACAAACCTGTC
r692AAAGAAGCCGGCAACAAACCTGGC
r693AATGAAGACAACAAAAAACCTGGT
r694AAAGAAGACAACAACAAATCTGGC
r695AAAGAAGACAACAAAAAGCCCAGC
r696AAAGAAGACGGCAACAAGCCTGAC
r697AAAGAAGACAACAACAAACCCGGC
r698AACGAAGACAACAAAAAACCTGGT
r699TAGGAAGACAATAACAAGCCTGGC
r700AAAGAAGATGGCAACAAGCCTGAC
r701AAAGAAGACCCCAACAAACCTGGT
r702GAGGAAGATGGCAACAAACCTGGT
r703AAAGAAGACAAGAAAAAACCTGGT
r705GAGGAAGACAACAAAAAACCCGGT
r706AAAGAAGACAACAAAAAACCGGGC
r707GAGTAAGACAACAACAAACCTGGT
r708AAAGAAGACAATGACAAGCCTGGC
r709AAAGAAGACAACAAAAAATTTGGT
r710AGAGAAGACGGCAACAAACCTGGC
r711AAAGAAGACGGCAACAAAACTGGC
r712GAGGAAGACAAAAACAAACCTGGT
r713AAAGAGGATAACAACAAACCTGGT
r714AAAGAAGACAACAACAAGCCCGGC
r715AAAGAAGACGGCAACAAACCTCGC
r716AAAGAAGACAAAAACAAACCTGGT
r717AAACAAGATGGCAACAAGCCTGGC
r718AAAGAAGATGGCAATAAACCTGGC
r719AAAGAAGACTGCAAAAAACCTGGT
r720AAAGAAGTCGGCAACAAACCTGGC
r721AAAGAAGATGGCAACAAACCTGCT
r722AAAGAAGACAACAACAAAGCTGGC
r723AAAGGAGACGGCAACAAGCCTGGC
r724GAGGAAAACAACAACAAACCTGGT
r725AAAGAAGACAACAACAAACCGGGT
r726GAAGAAGACAACAACAAACCTGGT
r727AAAGAAAACAACAACAAGCCTGGC
r728AAAGAAAATGGCAACAAGCCTGGT
r729AAAGATGACAACAACAAGCCTGGT
r730AAAGAAGACGGAAAAAAACCTGGC
r731AAAGAAGATGGCAACAAAAAGCCTAGC
r732AAAAAAGACAATAACAAGCCTGGC
r733GAGGAAGACAACAACATGCCTGGT
r734AAAGAAGACACCAAAAAACCTGGT
r735GAGGAAGACAACAATAAGCCTGGC
r736AAAGAAGATGGTAACAAACTTGGC
r737AAAGGAGATGGCAACAAGCCTGGT
r738AAAGGAGATGGCAACAAACCTGGT
r739AAACAAGACGGCAACAAACCTGGT
r740GAGAAAGACAACAACAAACCTGGC
r741GAGGAAGACAAAAACAAACCTAGT
r742GAGGAAGACAAAAACAAGCCTGGT
r743AAAGAAGACAAAAACAAGCCTGGT
r744AAAGAAGACAACAATAAGCCTGAC
r745AAAGAAGACAATAACAGGCCTGGT
r746AAAGGAGACGGCAACAAGCCTGGT
r747AAAGAAGACATCAAAAAACCTGGC
r748AAAGGAGACAACAAAAAACCTGGC
r749GAGGGAGACAACAAAAAACCTGGT
r750GGGGAAGACAACAAAAAACCTGGT
r751GAGGAAGACAACAACAACCCTGGT
r752AAAGAAGACCACAAAAAACCTGGC
r753AAAGAAGACAACAACAAACCTTGC
r754AAAGAAGACAACAAGAAGCCTGGT